SeqAn3  3.0.2
The Modern C++ library for sequence analysis.
The SeqAn Cookbook

This document provides example recipes on how to carry out particular tasks using the SeqAn functionalities in C++. Please note that these recipes are not ordered. You can use the links in the table of contents or the search function of your browser to navigate them.

It will take some time, but we hope to expand this document into containing numerous great examples. If you have suggestions for how to improve the Cookbook and/or examples you would like included, please feel free to contact us.

Read sequence files

#include <string>
#include <seqan3/core/debug_stream.hpp> // for debug_stream
#include <seqan3/io/sequence_file/input.hpp> // for sequence_file_input
int main ()
{
std::filesystem::path tmp_dir = std::filesystem::temp_directory_path(); // get the tmp directory
// Initialise a file input object with a FastA file.
seqan3::sequence_file_input file_in{tmp_dir/"seq.fasta"};
// Retrieve the sequences and ids.
for (auto & [seq, id, qual] : file_in)
{
seqan3::debug_stream << "ID: " << id << '\n';
seqan3::debug_stream << "SEQ: " << seq << '\n';
seqan3::debug_stream << "Empty Qual." << qual << '\n'; // qual is empty for FastAfiles
}
return 0;
}

Write a custom validator

This recipe implements a validator that checks if a numeric argument is an integral square (i.e. 0, 1, 4, 9...). Invalid values throw a seqan3::validation_error.

#include <cmath>
struct custom_validator
{
using option_value_type = double; // used for all arithmetic types
void operator() (option_value_type const & val) const
{
if ((std::round(val) != val) || // not an integer
(std::pow(std::round(std::sqrt(val)), 2) != val)) // not a square
{
throw seqan3::validation_error{"The provided number is not an arithmetic square."};
}
}
std::string get_help_page_message () const
{
return "Value must be the square of an integral number.";
}
};

Construction and assignment of alphabet symbols

#include <seqan3/alphabet/all.hpp> // for working with alphabets directly
using seqan3::operator""_dna4;
int main ()
{
// Two objects of seqan3::dna4 alphabet constructed with a char literal.
seqan3::dna4 ade = 'A'_dna4;
seqan3::dna4 gua = 'G'_dna4;
// Two additional objects assigned explicitly from char or rank.
seqan3::dna4 cyt, thy;
cyt.assign_char('C');
thy.assign_rank(3);
// Further code here...
return 0;
}
// Get the rank type of the alphabet (here uint8_t).
// Retrieve the numerical representation (rank) of the objects.
rank_type rank_a = ade.to_rank(); // => 0
rank_type rank_g = gua.to_rank(); // => 2

Reverse complement and the six-frame translation of a string using views

This recipe creates a small program that

  1. reads a string from the command line (first argument to the program)
  2. "converts" the string to a range of seqan3::dna5 (Bonus: throws an exception if loss of information occurs)
  3. prints the string and it's reverse complement
  4. prints the six-frame translation of the string
#include <seqan3/argument_parser/all.hpp> // optional: include the argument_parser
#include <seqan3/range/views/all.hpp> // include all of SeqAn's views
#include <seqan3/std/ranges> // include all of the standard library's views
int main(int argc, char** argv)
{
// We use the seqan3::argument_parser which was introduced in the second chapter
// of the tutorial: "Parsing command line arguments with SeqAn".
seqan3::argument_parser myparser{"Assignment-3", argc, argv}; // initialize
myparser.add_positional_option(s, "Please specify the DNA string.");
try
{
myparser.parse();
}
catch (seqan3::argument_parser_error const & ext) // the user did something wrong
{
std::cerr << "[PARSER ERROR]" << ext.what() << '\n'; // you can customize your error message
return 0;
}
auto s_as_dna = s | seqan3::views::char_to<seqan3::dna5>;
// Bonus:
//auto s_as_dna = s | std::views::transform([] (char const c)
//{
// return seqan3::assign_char_strictly_to(c, seqan3::dna5{});
//});
seqan3::debug_stream << "Original: " << s_as_dna << '\n';
seqan3::debug_stream << "RevComp: " << (s_as_dna | std::views::reverse | seqan3::views::complement) << '\n';
seqan3::debug_stream << "Frames: " << (s_as_dna | seqan3::views::translate) << '\n';
}

Reading records

After construction, you can now read the sequence records. Our file object behaves like a range so you can use a range-based for loop to conveniently iterate over the file:

#include <sstream>
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
int main()
{
for (auto & rec : fin)
{
seqan3::debug_stream << "ID: " << seqan3::get<seqan3::field::id>(rec) << '\n';
seqan3::debug_stream << "SEQ: " << seqan3::get<seqan3::field::seq>(rec) << '\n';
// a quality field also exists, but is not printed, because we know it's empty for FastA files.
}
}
Attention
An input file is a single input range, which means you can only iterate over it once!
Note
It is important to write auto & and not just auto, otherwise you will copy the record on every iteration.

You can also use structured binding, i.e. for (auto & [seq, id, qual] : fin) But beware: with structured bindings you do need to get the order of elements correct!

You can also read a file in chunks:

Reading records in chunks

// `&&` is important because seqan3::views::chunk returns temporaries!
for (auto && records : fin | ranges::views::chunk(10))
{
// `records` contains 10 elements (or less at the end)
seqan3::debug_stream << "Taking the next 10 sequences:\n";
seqan3::debug_stream << "ID: " << seqan3::get<seqan3::field::id>(*records.begin()) << '\n';
} // prints first ID in batch

The example above will iterate over the file by reading 10 records at a time. If no 10 records are available anymore, it will just print the remaining records.

Applying a filter to a file

On some occasions you are only interested in sequence records that fulfill a certain criterion, e.g. having a minimum sequence length or a minimum average quality.

This recipe can be used to filter the sequences in your file by a custom criterion.

// std::views::filter takes a function object (a lambda in this case) as input that returns a boolean
auto minimum_quality_filter = std::views::filter([] (auto const & rec)
{
auto qual = seqan3::get<seqan3::field::qual>(rec) | std::views::transform([] (auto q) { return q.to_phred(); });
double sum = std::accumulate(qual.begin(), qual.end(), 0);
return sum / std::ranges::size(qual) >= 40; // minimum average quality >= 40
});
for (auto & rec : fin | minimum_quality_filter)
{
seqan3::debug_stream << "ID: " << seqan3::get<seqan3::field::id>(rec) << '\n';
}

Reading paired-end reads

In modern Next Generation Sequencing experiments you often have paired-end read data which is split into two files. The read pairs are identified by their identical name/id and position in the two files.

This recipe can be used to handle one pair of reads at a time.

// for simplicity we take the same file
for (auto && [rec1, rec2] : seqan3::views::zip(fin1, fin2)) // && is important!
{ // because seqan3::views::zip returns temporaries
if (seqan3::get<seqan3::field::id>(rec1) != seqan3::get<seqan3::field::id>(rec2))
throw std::runtime_error("Oh oh your pairs don't match.");
}

Storing records in a std::vector

This recipe creates a small program that reads in a FASTA file and stores all the records in a std::vector.

#include <seqan3/std/ranges> // std::ranges::copy
int main()
{
std::filesystem::path tmp_dir = std::filesystem::temp_directory_path(); // get the temp directory
seqan3::sequence_file_input fin{tmp_dir/"my.fasta"};
using record_type = decltype(fin)::record_type;
// You can use a for loop:
// for (auto & rec : fin)
// {
// records.push_back(std::move(rec));
// }
// But you can also do this:
std::ranges::copy(fin, std::cpp20::back_inserter(records));
seqan3::debug_stream << records << '\n';
}

Note that you can move the record out of the file if you want to store it somewhere without copying.

record_type rec = std::move(*fin.begin()); // avoid copying

Writing records

The easiest way to write to a sequence file is to use the seqan3::sequence_file_output::push_back() or seqan3::sequence_file_output::emplace_back() member functions. These work similarly to how they work on a std::vector.

#include <sstream>
#include <string>
#include <tuple>
int main()
{
using seqan3::operator""_dna5;
for (int i = 0; i < 5; ++i) // ...
{
std::string id{"test_id"};
seqan3::dna5_vector seq{"ACGT"_dna5};
// ...
fout.emplace_back(seq, id); // as individual variables
// or:
fout.push_back(std::tie(seq, id)); // as a tuple
}
}

File conversion

seqan3::sequence_file_output{tmp_dir/"output.fasta"} = seqan3::sequence_file_input{tmp_dir/"my.fastq"};

Define a custom scoring scheme

using seqan3::operator""_dna4;
using seqan3::operator""_aa27;
// Define a simple scoring scheme with match and mismatch cost and get the score.
auto sc_nc = nc_scheme.score('A'_dna4, 'C'_dna4); // sc_nc == -5.
// Define a amino acid similarity matrix and get the score.
auto sc_aa = aa_scheme.score('M'_aa27, 'K'_aa27); // sc_aa == 2.
Attention
SeqAn's alignment algorithm computes the maximal similarity score, thus the match score must be set to a positive value and the scores for mismatch and gap must be negative in order to maximize over the matching letters.

Calculate edit distance for a set of sequences

This recipe can be used to calculate the edit distance for all six pairwise combinations. Here we only allow at most 7 errors and filter all alignments with 6 or less errors.

#include <utility>
#include <vector>
using seqan3::operator""_dna4;
int main()
{
std::vector vec{"ACGTGACTGACT"_dna4,
"ACGAAGACCGAT"_dna4,
"ACGTGACTGACT"_dna4,
"AGGTACGAGCGACACT"_dna4};
// Configure the alignment kernel.
auto filter_v = std::views::filter([](auto && res) { return res.score() >= -6;});
for (auto const & res : seqan3::align_pairwise(seqan3::views::pairwise_combine(vec), config) | seqan3::views::persist | filter_v)
{
seqan3::debug_stream << "Score: " << res.score() << '\n';
}
}

Searching for matches

This recipe can be used to search for all occurrences of a substring and print the number of hits and the positions in an ascending ordering.

using seqan3::operator""_dna4;
void run_text_single()
{
seqan3::dna4_vector
text{"CGCTGTCTGAAGGATGAGTGTCAGCCAGTGTAACCCGATGAGCTACCCAGTAGTCGAACTGGGCCAGACAACCCGGCGCTAATGCACTCA"_dna4};
seqan3::fm_index index{text};
seqan3::debug_stream << "===== Running on a single text =====\n"
<< "The following hits were found:\n";
for (auto && result : search("GCT"_dna4, index))
seqan3::debug_stream << result << '\n';
}
void run_text_collection()
{
std::vector<seqan3::dna4_vector> text{"CGCTGTCTGAAGGATGAGTGTCAGCCAGTGTA"_dna4,
"ACCCGATGAGCTACCCAGTAGTCGAACTG"_dna4,
"GGCCAGACAACCCGGCGCTAATGCACTCA"_dna4};
seqan3::fm_index index{text};
seqan3::debug_stream << "===== Running on a text collection =====\n"
<< "The following hits were found:\n";
for (auto && result : search("GCT"_dna4, index))
seqan3::debug_stream << result << '\n';
}
int main()
{
run_text_single();
run_text_collection();
}

If you want to allow errors in your query, you need to configure the approximate search with the following search configuration objects:

To search for either 1 insertion or 1 deletion you can use the seqan3::search_cfg::error_count:

std::string text{"Garfield the fat cat without a hat."};
seqan3::fm_index index{text};
seqan3::debug_stream << search("cat"s, index, cfg) << '\n';
// prints: [<query_id:0, reference_id:0, reference_pos:14>,
// <query_id:0, reference_id:0, reference_pos:17>,
// <query_id:0, reference_id:0, reference_pos:18>,
// <query_id:0, reference_id:0, reference_pos:32>]

Reading the CIGAR information into an actual alignment

In SeqAn, the conversion from a CIGAR string to an alignment (two aligned_sequences) is done automatically for you. You can access it by querying seqan3::field::alignment from the record:

auto filename = std::filesystem::temp_directory_path()/"example.sam";
for (auto & [ id, alignment ] : fin)
{
seqan3::debug_stream << id << ": " << std::get<1>(alignment) << '\n';
}

Combining sequence and alignment files

This recipe can be used to:

  1. Read in a FASTA file with the reference and a SAM file with the alignment
  2. Filter the alignment records and only take those with a mapping quality >= 30.
  3. For the resulting alignments, print which read was mapped against with reference id and the number of seqan3::gap's involved in the alignment (either in aligned reference or in read sequence).
#include <string>
#include <vector>
int main()
{
std::filesystem::path tmp_dir = std::filesystem::temp_directory_path(); // get the temp directory
// read in reference information
seqan3::sequence_file_input reference_file{tmp_dir/"reference.fasta"};
for (auto && record : reference_file)
{
ref_ids.push_back(std::move(seqan3::get<seqan3::field::id>(record)));
ref_seqs.push_back(std::move(seqan3::get<seqan3::field::seq>(record)));
}
using field_type = seqan3::fields<seqan3::field::id,
seqan3::alignment_file_input mapping_file{tmp_dir/"mapping.sam", ref_ids, ref_seqs, field_type{}};
#if !SEQAN3_WORKAROUND_GCC_93983
auto mapq_filter = std::views::filter([] (auto & rec) { return seqan3::get<seqan3::field::mapq>(rec) >= 30; });
#endif // !SEQAN3_WORKAROUND_GCC_93983
#if SEQAN3_WORKAROUND_GCC_93983
for (auto & [id, ref_id, mapq, alignment] : mapping_file /*| mapq_filter*/)
#else // ^^^ workaround / no workaround vvv
for (auto & [id, ref_id, mapq, alignment] : mapping_file | mapq_filter)
#endif // SEQAN3_WORKAROUND_GCC_93983
{
using seqan3::get;
size_t sum_ref{};
for (auto const & char_ref : get<0>(alignment))
if (char_ref == seqan3::gap{})
++sum_ref;
size_t sum_read{};
for (auto const & char_read : get<1>(alignment))
if (char_read == seqan3::gap{})
++sum_read;
seqan3::debug_stream << id << " mapped against " << ref_id << " with "
<< sum_read << " gaps in the read sequence and "
<< sum_ref << " gaps in the reference sequence.\n";
}
}

Map reads ans write output to SAM file

For a full recipe on creating your own readmapper, see the very end of the tutorial Implementing your own read mapper with SeqAn.

void map_reads(std::filesystem::path const & query_path,
std::filesystem::path const & index_path,
std::filesystem::path const & sam_path,
reference_storage_t & storage,
uint8_t const errors)
{
// we need the alphabet and text layout before loading
{
std::ifstream is{index_path, std::ios::binary};
cereal::BinaryInputArchive iarchive{is};
iarchive(index);
}
seqan3::sequence_file_input query_file_in{query_path};
for (auto && record : query_file_in)
{
auto & query = seqan3::get<seqan3::field::seq>(record);
for (auto && result : search(query, index, search_config))
{
size_t start = result.reference_begin_position() ? result.reference_begin_position() - 1 : 0;
std::span text_view{std::data(storage.seqs[result.reference_id()]) + start, query.size() + 1};
for (auto && alignment : seqan3::align_pairwise(std::tie(text_view, query), align_config))
{
auto aligned_seq = alignment.alignment();
size_t ref_offset = alignment.sequence1_begin_position() + 2 + start;
size_t map_qual = 60u + alignment.score();
sam_out.emplace_back(query,
seqan3::get<seqan3::field::id>(record),
storage.ids[result.reference_id()],
ref_offset,
aligned_seq,
seqan3::get<seqan3::field::qual>(record),
map_qual);
}
}
}
}

Constructing a basic argument parser

void run_program(std::filesystem::path const & reference_path,
std::filesystem::path const & index_path)
{
seqan3::debug_stream << "reference_file_path: " << reference_path << '\n';
seqan3::debug_stream << "index_path " << index_path << '\n';
}
struct cmd_arguments
{
std::filesystem::path reference_path{};
std::filesystem::path index_path{"out.index"};
};
void initialise_argument_parser(seqan3::argument_parser & parser, cmd_arguments & args)
{
parser.info.author = "E. coli";
parser.info.short_description = "Creates an index over a reference.";
parser.info.version = "1.0.0";
parser.add_option(args.reference_path, 'r', "reference", "The path to the reference.",
seqan3::input_file_validator{{"fa","fasta"}});
parser.add_option(args.index_path, 'o', "output", "The output index file path.",
}
int main(int argc, char const ** argv)
{
seqan3::argument_parser parser("Indexer", argc, argv);
cmd_arguments args{};
initialise_argument_parser(parser, args);
try
{
parser.parse();
}
catch (seqan3::argument_parser_error const & ext)
{
std::cerr << "[PARSER ERROR] " << ext.what() << '\n';
return -1;
}
run_program(args.reference_path, args.index_path);
return 0;
}

Constructing a subcommand argument parser

// =====================================================================================================================
// pull
// =====================================================================================================================
struct pull_arguments
{
std::string repository{};
std::string branch{};
bool progress{false};
};
int run_git_pull(seqan3::argument_parser & parser)
{
pull_arguments args{};
parser.add_positional_option(args.repository, "The repository name to pull from.");
parser.add_positional_option(args.branch, "The branch name to pull from.");
try
{
parser.parse();
}
catch (seqan3::argument_parser_error const & ext)
{
seqan3::debug_stream << "[Error git pull] " << ext.what() << "\n";
return -1;
}
seqan3::debug_stream << "Git pull with repository " << args.repository << " and branch " << args.branch << '\n';
return 0;
}
// =====================================================================================================================
// push
// =====================================================================================================================
struct push_arguments
{
std::string repository{};
bool push_all{false};
};
int run_git_push(seqan3::argument_parser & parser)
{
push_arguments args{};
parser.add_positional_option(args.repository, "The repository name to push to.");
parser.add_positional_option(args.branches, "The branch names to push (if none are given, push current).");
try
{
parser.parse();
}
catch (seqan3::argument_parser_error const & ext)
{
seqan3::debug_stream << "[Error git push] " << ext.what() << "\n";
return -1;
}
seqan3::debug_stream << "Git push with repository " << args.repository << " and branches " << args.branches << '\n';
return 0;
}
// =====================================================================================================================
// main
// =====================================================================================================================
int main(int argc, char const ** argv)
{
seqan3::argument_parser top_level_parser{"mygit", argc, argv, true, {"push", "pull"}};
// Add information and flags to your top-level parser just as you would do with a normal one.
// Note that all flags directed at the top-level parser must be specified BEFORE the subcommand key word.
// Because of ambiguity, we do not allow any (positional) options for the top-level parser.
top_level_parser.info.description.push_back("You can push or pull from a remote repository.");
bool flag{false};
top_level_parser.add_flag(flag, 'f', "flag", "some flag");
try
{
top_level_parser.parse(); // trigger command line parsing
}
catch (seqan3::argument_parser_error const & ext) // catch user errors
{
seqan3::debug_stream << "[Error] " << ext.what() << "\n"; // customise your error message
return -1;
}
seqan3::argument_parser & sub_parser = top_level_parser.get_sub_parser(); // hold a reference to the sub_parser
std::cout << "Proceed to sub parser.\n";
if (sub_parser.info.app_name == std::string_view{"mygit-pull"})
run_git_pull(sub_parser);
else if (sub_parser.info.app_name == std::string_view{"mygit-push"})
run_git_push(sub_parser);
else
throw std::logic_error{"I do not know sub parser " + sub_parser.info.app_name};
}

Serialise data structures with cereal

#include <fstream>
#include <vector>
#include <cereal/archives/binary.hpp> // includes the cereal::BinaryInputArchive and cereal::BinaryOutputArchive
#include <cereal/types/vector.hpp> // includes cerealisation support for std::vector
#include <seqan3/test/tmp_filename.hpp>
// Written for std::vector, other types also work.
void load(std::vector<int16_t> & data, seqan3::test::tmp_filename & tmp_file)
{
std::ifstream is(tmp_file.get_path(), std::ios::binary); // Where input can be found.
cereal::BinaryInputArchive archive(is); // Create an input archive from the input stream.
archive(data); // Load data.
}
// Written for std::vector, other types also work.
void store(std::vector<int16_t> const & data, seqan3::test::tmp_filename & tmp_file)
{
std::ofstream os(tmp_file.get_path(), std::ios::binary); // Where output should be stored.
cereal::BinaryOutputArchive archive(os); // Create an ouput archive from the output stream.
archive(data); // Store data.
}
int main()
{
// The following example is for an std::vector but any seqan3 data structure that is documented as serialisable
// could be used, e.g. seqan3::fm_index.
seqan3::test::tmp_filename tmp_file{"data.out"}; // This is a temporary file, use any other filename.
std::vector<int16_t> vec{1,2,3,4};
store(vec, tmp_file); // Calls store on a std::vector.
// This vector is needed to load the information into it.
load(vec2, tmp_file); // Calls load on a std::vector.
seqan3::debug_stream << vec2 << '\n'; // Prints [1,2,3,4].
return 0;
}

A custom dna4 alphabet that converts all unknown characters to <tt>A</tt>

When assigning from char or converting from a larger nucleotide alphabet to a smaller one, loss of information can occur since obviously some bases are not available. When converting to seqan3::dna5 or seqan3::rna5, non-canonical bases (letters other than A, C, G, T, U) are converted to ‘'N’to preserve ambiguity at that position. For seqan3::dna4 and seqan3::rna4 there is no letter'N'to represent ambiguity, so the conversion fromchar` for IUPAC characters tries to choose the best fitting alternative (see seqan3::dna4 for more details).

If you would like to always convert unknown characters to A instead, you can create your own alphabet with a respective char conversion table very easily like this:

// We inherit from seqan3::nucleotide_base s.t. we do not need to implement the full nucleotide interface
// but it is sufficient to define `rank_to_char`, `char_to_rank`, and `complement_table`.
class my_dna4 : public seqan3::nucleotide_base<my_dna4, 4/*alphabet size is 4*/>
{
public:
using nucleotide_base<my_dna4, 4>::nucleotide_base; // Use constructors of the base class.
private:
// Value to char conversion table.
static constexpr char_type rank_to_char[alphabet_size] {'A', 'C', 'G', 'T'}; // rank 0,1,2,3
// Char-to-value conversion table. This is where char conversion for assign_char() is handled!
static constexpr std::array<rank_type, 256> char_to_rank
{
[] () constexpr
{
std::array<rank_type, 256> conversion_table{}; // By default now, everything has rank 0 which equals `A`.
conversion_table['C'] = conversion_table['c'] = 1;
conversion_table['G'] = conversion_table['g'] = 2;
conversion_table['T'] = conversion_table['t'] = 3;
conversion_table['U'] = conversion_table['T']; // set U equal to T
conversion_table['u'] = conversion_table['t']; // set u equal to t
return conversion_table;
}()
};
// The forward declaration of the complement table. With this, my_dna4 models seqan3::nucleotide_alphabet.
static const std::array<my_dna4, alphabet_size> complement_table;
friend nucleotide_base<my_dna4, 4>; // Grant seqan3::nucleotide_base access to private/protected members.
friend nucleotide_base<my_dna4, 4>::base_t; // Grant seqan3::alphabet_base access to private/protected members.
};
// Defines the `_my_dna4` *char literal* so you can write `'C'_my_dna4` instead of `my_dna4{}.assign_char('C')`.
constexpr my_dna4 operator""_my_dna4(char const c) noexcept
{
return my_dna4{}.assign_char(c);
}
// The definition of the complement table. With this, my_dna4 models seqan3::nucleotide_alphabet.
constexpr std::array<my_dna4, my_dna4::alphabet_size> my_dna4::complement_table
{
'T'_my_dna4, // the complement of 'A'_my_dna4
'G'_my_dna4, // the complement of 'C'_my_dna4
'C'_my_dna4, // the complement of 'G'_my_dna4
'A'_my_dna4 // the complement of 'T'_my_dna4
};
int main()
{
my_dna4 my_letter{'C'_my_dna4};
my_letter.assign_char('S'); // Characters other than A,C,G,T are implicitly converted to `A`.
seqan3::debug_stream << my_letter; // "A";
}

If you are interested in custom alphabets, also take a look at our tutorial How to write your own alphabet.

debug_stream.hpp
Provides seqan3::debug_stream and related types.
seqan3::align_cfg::free_end_gaps_sequence1_trailing
A strong type representing free_end_gaps_sequence1_trailing of the seqan3::align_cfg::method_global.
Definition: align_config_method.hpp:85
sstream
seqan3::gap
The alphabet of a gap character '-'.
Definition: gap.hpp:37
seqan3::field::seq
@ seq
The "sequence", usually a range of nucleotides or amino acids.
dna4.hpp
Provides seqan3::dna4, container aliases and string literals.
fstream
std::string
seqan3::argument_parser_meta_data::short_description
std::string short_description
A short description of the application (e.g. "A tool for mapping reads to the genome").
Definition: auxiliary.hpp:273
align_pairwise.hpp
Provides pairwise alignment function.
utility
seqan3::argument_parser::get_sub_parser
argument_parser & get_sub_parser()
Returns a reference to the sub-parser instance if subcommand parsing was enabled.
Definition: argument_parser.hpp:408
seqan3::argument_parser_meta_data::description
std::vector< std::string > description
A more detailed description that is displayed on the help page in the section "DESCRIPTION"....
Definition: auxiliary.hpp:303
seqan3::search_cfg::hit_all_best
Configuration element to receive all hits with the lowest number of errors within the error bounds.
Definition: hit.hpp:56
std::string_view
seqan3::argument_parser
The SeqAn command line parser.
Definition: argument_parser.hpp:154
seqan3::fm_index
The SeqAn FM Index.
Definition: fm_index.hpp:194
seqan3::align_cfg::free_end_gaps_sequence2_leading
A strong type representing free_end_gaps_sequence2_leading of the seqan3::align_cfg::method_global.
Definition: align_config_method.hpp:75
seqan3::alphabet_base< derived_type, size, char >::alphabet_size
static constexpr detail::min_viable_uint_t< size > alphabet_size
The size of the alphabet, i.e. the number of different values it can take.
Definition: alphabet_base.hpp:176
std::filesystem::temp_directory_path
T temp_directory_path(T... args)
seqan3::search_cfg::max_error_substitution
Configuration element that represents the number or rate of substitution errors.
Definition: max_error.hpp:80
std::vector
seqan3::aminoacid_similarity_matrix::BLOSUM30
@ BLOSUM30
The BLOSUM30 matrix for very distantly related proteins.
seqan3::argument_parser::add_option
void add_option(option_type &value, char const short_id, std::string const &long_id, std::string const &desc, option_spec const spec=option_spec::DEFAULT, validator_type option_validator=validator_type{})
Adds an option to the seqan3::argument_parser.
Definition: argument_parser.hpp:237
seqan3::argument_parser_meta_data::version
std::string version
The version information MAJOR.MINOR.PATH (e.g. 3.1.3)
Definition: auxiliary.hpp:271
seqan3::align_cfg::free_end_gaps_sequence1_leading
A strong type representing free_end_gaps_sequence1_leading of the seqan3::align_cfg::method_global.
Definition: align_config_method.hpp:65
seqan3::search_cfg::max_error_total
Configuration element that represents the number or rate of total errors.
Definition: max_error.hpp:36
seqan3::DEFAULT
@ DEFAULT
The default were no checking or special displaying is happening.
Definition: auxiliary.hpp:234
seqan3::get
constexpr auto const & get(configuration< configs_t... > const &config) noexcept
This is an overloaded member function, provided for convenience. It differs from the above function o...
Definition: configuration.hpp:627
seqan3::nucleotide_scoring_scheme
A data structure for managing and computing the score of two nucleotides.
Definition: nucleotide_scoring_scheme.hpp:38
seqan3::field::id
@ id
The identifier, usually a string.
std::istringstream
seqan3::alignment_file_output
A class for writing alignment files, e.g. SAM, BAL, BLAST, ...
Definition: output.hpp:163
tuple
nucleotide_scoring_scheme.hpp
Provides seqan3::nucleotide_scoring_scheme.
std::cerr
record.hpp
Provides the seqan3::record template and the seqan3::field enum.
seqan3::align_cfg::edit_scheme
constexpr configuration edit_scheme
Shortcut for edit distance configuration.
Definition: align_config_edit.hpp:51
input.hpp
Provides seqan3::sequence_file_input and corresponding traits classes.
all.hpp
Meta-header for the views submodule .
seqan3::nucleotide_base
A CRTP-base that refines seqan3::alphabet_base and is used by the nucleotides.
Definition: nucleotide_base.hpp:41
filesystem
This header includes C++17 filesystem support and imports it into namespace std::filesystem (independ...
seqan3::align_pairwise
constexpr auto align_pairwise(sequence_t &&seq, alignment_config_t const &config)
Computes the pairwise alignment for a pair of sequences or a range over sequence pairs.
Definition: align_pairwise.hpp:139
seqan3::format_fasta
The FastA format.
Definition: format_fasta.hpp:80
seqan3::search_cfg::max_error_deletion
Configuration element that represents the number or rate of deletion errors.
Definition: max_error.hpp:169
cmath
seqan3::search_cfg::max_error_insertion
Configuration element that represents the number or rate of insertion errors.
Definition: max_error.hpp:124
seqan3::field::ref_offset
@ ref_offset
Sequence (REF_SEQ) relative start position (0-based), unsigned value.
std::filesystem::path
seqan3::bi_fm_index
The SeqAn Bidirectional FM Index.
Definition: bi_fm_index.hpp:66
std::sqrt
T sqrt(T... args)
seqan3::views::complement
auto const complement
A view that converts a range of nucleotides to their complement.
Definition: complement.hpp:69
seqan3::views::persist
constexpr auto persist
A view adaptor that wraps rvalue references of non-views.
Definition: persist.hpp:233
seqan3::fields
A class template that holds a choice of seqan3::field.
Definition: record.hpp:166
std::tie
T tie(T... args)
std::vector::push_back
T push_back(T... args)
seqan3::seq
constexpr sequenced_policy seq
Global execution policy object for sequenced execution policy.
Definition: execution.hpp:54
std::cout
seqan3::alphabet_base::assign_char
constexpr derived_type & assign_char(char_type const c) noexcept
Assign from a character, implicitly converts invalid characters.
Definition: alphabet_base.hpp:142
seqan3::input_file_validator
A validator that checks if a given path is a valid input file.
Definition: validators.hpp:484
aminoacid_scoring_scheme.hpp
Provides seqan3::aminoacid_scoring_scheme.
seqan3::align_cfg::output_alignment
Configures the alignment result to output the alignment.
Definition: align_config_output.hpp:168
seqan3::alphabet_rank_t
decltype(seqan3::to_rank(std::declval< semi_alphabet_type >())) alphabet_rank_t
The rank_type of the semi-alphabet; defined as the return type of seqan3::to_rank.
Definition: concept.hpp:152
seqan3::alignment_file_input
A class for reading alignment files, e.g. SAM, BAM, BLAST ...
Definition: input.hpp:353
seqan3::configuration
Collection of elements to configure an algorithm.
Definition: configuration.hpp:82
pairwise_combine.hpp
Provides seqan3::views::pairwise_combine.
seqan3::mismatch_score
A strong type of underlying type score_type that represents the score two different characters.
Definition: scoring_scheme_base.hpp:66
seqan3::views::translate
constexpr auto translate
A view that translates nucleotide into aminoacid alphabet with 1, 2, 3 or 6 frames.
Definition: translate.hpp:780
seqan3::views::pairwise_combine
constexpr auto pairwise_combine
A view adaptor that generates all pairwise combinations of the elements of the underlying range.
Definition: pairwise_combine.hpp:708
seqan3::align_cfg::output_begin_position
Configures the alignment result to output the begin positions.
Definition: align_config_output.hpp:129
output.hpp
Provides seqan3::sequence_file_output and corresponding traits classes.
seqan3::views::move
auto const move
A view that turns lvalue-references into rvalue-references.
Definition: move.hpp:68
seqan3::argument_parser::add_positional_option
void add_positional_option(option_type &value, std::string const &desc, validator_type option_validator=validator_type{})
Adds a positional option to the seqan3::argument_parser.
Definition: argument_parser.hpp:300
seqan3::search_cfg::error_count
A strong type of underlying type uint8_t that represents the number of errors.
Definition: max_error_common.hpp:30
std::ofstream
seqan3::field::mapq
@ mapq
The mapping quality of the SEQ alignment, usually a ohred-scaled score.
seqan3::REQUIRED
@ REQUIRED
Definition: auxiliary.hpp:235
all.hpp
Meta-include for the sequence IO submodule.
seqan3::dna4
The four letter DNA alphabet of A,C,G,T.
Definition: dna4.hpp:51
dna5.hpp
Provides seqan3::dna5, container aliases and string literals.
gap.hpp
Provides seqan3::gap.
std::array< rank_type, 256 >
seqan3::sequence_file_output
A class for writing sequence files, e.g. FASTA, FASTQ ...
Definition: output.hpp:168
search.hpp
Provides the public interface for search algorithms.
all.hpp
Meta-header for the alphabet module.
std::runtime_error
std::accumulate
T accumulate(T... args)
seqan3::argument_parser_meta_data::author
std::string author
Your name ;-)
Definition: auxiliary.hpp:275
std::logic_error
alignment_file_input_traits::ref_ids
using ref_ids
The type of range over reference sequences; must model std::ranges::forward_range,...
seqan3::align_cfg::free_end_gaps_sequence2_trailing
A strong type representing free_end_gaps_sequence2_trailing of the seqan3::align_cfg::method_global.
Definition: align_config_method.hpp:95
seqan3::align_cfg::output_score
Configures the alignment result to output the score.
Definition: align_config_output.hpp:43
seqan3::pack_traits::size
constexpr size_t size
The size of a type pack.
Definition: traits.hpp:116
seqan3::align_cfg::min_score
Sets the minimal score (maximal errors) allowed during an distance computation e.g....
Definition: align_config_min_score.hpp:37
nucleotide_base.hpp
Provides seqan3::nucleotide_base.
std::ostringstream
ranges
Adaptations of concepts from the Ranges TS.
all.hpp
Meta-Header for the argument parser module.
std::round
T round(T... args)
seqan3::validation_error
Argument parser exception thrown when an argument could not be casted to the according type.
Definition: exceptions.hpp:141
seqan3::sequence_file_input
A class for reading sequence files, e.g. FASTA, FASTQ ...
Definition: input.hpp:316
seqan3::aminoacid_scoring_scheme
A data structure for managing and computing the score of two amino acids.
Definition: aminoacid_scoring_scheme.hpp:75
seqan3::align_cfg::method_global
Sets the global alignment method.
Definition: align_config_method.hpp:106
seqan3::field::ref_id
@ ref_id
The identifier of the (reference) sequence that SEQ was aligned to.
seqan3::argument_parser_error
Argument parser exception that is thrown whenever there is an error while parsing the command line ar...
Definition: exceptions.hpp:49
input.hpp
Provides seqan3::alignment_file_input and corresponding traits classes.
seqan3::aminoacid_scoring_scheme::set_similarity_matrix
constexpr void set_similarity_matrix(aminoacid_similarity_matrix const matrix_id)
Set the similarity matrix scheme (e.g. BLOSUM62).
Definition: aminoacid_scoring_scheme.hpp:122
seqan3::field::qual
@ qual
The qualities, usually in phred-score notation.
seqan3::argument_parser::info
argument_parser_meta_data info
Aggregates all parser related meta data (see seqan3::argument_parser_meta_data struct).
Definition: argument_parser.hpp:530
seqan3::debug_stream
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:42
seqan3::alphabet_base::assign_rank
constexpr derived_type & assign_rank(rank_type const c) noexcept
Assign from a numeric value.
Definition: alphabet_base.hpp:167
seqan3::argument_parser::parse
void parse()
Initiates the actual command line parsing.
Definition: argument_parser.hpp:387
seqan3::pack_traits::transform
seqan3::type_list< trait_t< pack_t >... > transform
Apply a transformation trait to every type in the pack and return a seqan3::type_list of the results.
Definition: traits.hpp:307
seqan3::field::flag
@ flag
The alignment flag (bit information), uint16_t value.
seqan3::search
auto search(queries_t &&queries, index_t const &index, configuration_t const &cfg=search_cfg::default_configuration)
Search a query or a range of queries in an index.
Definition: search.hpp:105
seqan3::match_score
A strong type of underlying type score_type that represents the score of two matching characters.
Definition: scoring_scheme_base.hpp:41
fm_index.hpp
Provides the unidirectional seqan3::fm_index.
seqan3::alphabet_base::to_rank
constexpr rank_type to_rank() const noexcept
Return the letter's numeric value (rank in the alphabet).
Definition: alphabet_base.hpp:118
seqan3::output_file_validator
A validator that checks if a given path is a valid output file.
Definition: validators.hpp:601
std::data
T data(T... args)
seqan3::argument_parser_meta_data::app_name
std::string app_name
The application name that will be displayed on the help page.
Definition: auxiliary.hpp:269
std::runtime_error::what
T what(T... args)
seqan3::field::alignment
@ alignment
The (pairwise) alignment stored in an seqan3::alignment object.
std::ifstream
std::pow
T pow(T... args)
string